About   Help   FAQ
Rnf187em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rnf187em1(IMPC)J
Name: ring finger protein 187; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6849819
Gene: Rnf187  Location: Chr11:58823114-58829732 bp, - strand  Genetic Position: Chr11, 36.37 cM, cytoband B2
Alliance: Rnf187em1(IMPC)J page
IMPC: Rnf187 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAGTCCTTGGAACCTGGTCA and ATAAGATTACTCATCCTGCA, which resulted in a 6959 bp deletion beginning at Chromosome 11 position 58,823,054 bp and ending after 58,830,012 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000590381, ENSMUSE00000105447, ENSMUSE00000105448 and ENSMUSE00000678141 (exons 1-4) and 5010 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. There is a 1 bp (T) insertion at the deletion site. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rnf187 Mutation:  8 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory