Dmwdem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Dmwdem1(IMPC)J |
| Name: |
dystrophia myotonica-containing WD repeat motif; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6849816 |
| Gene: |
Dmwd Location: Chr7:18810152-18816701 bp, + strand Genetic Position: Chr7, 9.46 cM
|
| Alliance: |
Dmwdem1(IMPC)J page
|
| IMPC: |
Dmwd gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCGTAGCCAACCAAACGCGA and TCTCGACCCCCAAAGTCAAG, which resulted in a 6894 bp deletion beginning at Chromosome 7 position 18,809,966 bp and ending after 18,816,859 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000676908, ENSMUSE00000198585, ENSMUSE00001284052, ENSMUSE00001300660 and ENSMUSE00000412301 (exons 1-5) and 2494 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. There is an 18 bp insertion AAGGCTCATCTACCAAAA at the deletion site.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|