Ankrd13b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ankrd13b^em1(IMPC)J
• Name: ankyrin repeat domain 13b; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6849806
• Gene: Ankrd13b Location: Chr11:77361311-77380504 bp, - strand Genetic Position: Chr11, 46.59 cM
• Alliance: Ankrd13b^em1(IMPC)J page
• IMPC: Ankrd13b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAAGCACTCCACCAAGCTG and GTACAGCTAGAAAAGAACTA, which resulted in a 1010 bp deletion beginning at Chromosome 11 position 77,366,728 bp and ending after 77,367,737 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000587539, ENSMUSE00001279228 and ENSMUSE00001227155 (exons 5,6,7) and 609 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 140 and early truncation 22 amino acids later. There is a 4 bp insertion AGGA at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ankrd13b Mutation: 29 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)