About   Help   FAQ
Rnf126em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rnf126em1(IMPC)J
Name: ring finger protein 126; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6838377
Gene: Rnf126  Location: Chr10:79594349-79602786 bp, - strand  Genetic Position: Chr10, 39.72 cM, cytoband C1
Alliance: Rnf126em1(IMPC)J page
IMPC: Rnf126 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAAACCTCAGGGGTATCAG and CCAATGGTGAGGAAGCCATT, which resulted in a 587 bp deletion beginning at Chromosome 10 position 79,597,047 bp and ending after 79,597,633 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000316115 and ENSMUSE00000316109 (exons 5 and 6) and 448 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 148 and early truncation 92 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rnf126 Mutation:  28 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory