Banf1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Banf1em1(IMPC)J |
| Name: |
BAF nuclear assembly factor 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6836771 |
| Synonyms: |
Banf1- |
| Gene: |
Banf1 Location: Chr19:5414661-5416904 bp, - strand Genetic Position: Chr19, 4.31 cM, cytoband A
|
| Alliance: |
Banf1em1(IMPC)J page
|
| IMPC: |
Banf1 gene page |
|
Banf1em1(IMPC)J/Banf1em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts in vitro fail to hatch from the zona pellucida.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTAGGAATTGGGACACCCA and TGGAAATTTCCGAATAGCCG, which resulted in a 1621 bp deletion beginning at Chromosome 19 position 5,414,502 bp and ending after 5,416,122 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000145472 and ENSMUSE00000413957 (exons 2 and 3) and 961 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to create a null allele.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|