Cct8^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cct8^em1(IMPC)J
• Name: chaperonin containing TCP1 subunit 8; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6836735
• Synonyms: Cct8^-
• Gene: Cct8 Location: Chr16:87280213-87292757 bp, - strand Genetic Position: Chr16, 49.57 cM, cytoband C3.3
• Alliance: Cct8^em1(IMPC)J page
• IMPC: Cct8 gene page

Cct8^em1(IMPC)J/Cct8^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts grown in vitro fail to hatch from the zona pellucida.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences AAGTGAAAGAGACGTGTACG and GAGATCTTACTTGAGTAAGG that targeted exon(s) ENSMUSE00000949340.2 ENSMUSE00001206188.2 ENSMUSE00001223260.2 ENSMUSE00001247901.2 ENSMUSE00001252459.2 ENSMUSE00001275047.2. This resulted in deletion(s) of 4192 bp (location: Chr16:87284234-87288425; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cct8 Mutation: 30 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)