About   Help   FAQ
Apelaem1Zyq
Endonuclease-mediated Allele Detail
Summary
Symbol: Apelaem1Zyq
Name: apelin receptor early endogenous ligand; endonuclease-mediated mutation 1, Qing Zhu
MGI ID: MGI:6833992
Gene: Apela  Location: Chr8:65481069-65489970 bp, - strand  Genetic Position: Chr8, 32.52 cM
Alliance: Apelaem1Zyq page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Not Specified
 
Mutation detailsCRISPR-targeting with guides ACCGCACAGACTGGAAATCCTCGG (sense) and AAACCCGAGGATTTCCAGTCTGTG (antisense) generated a null allele. (J:314153)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Apela Mutation:  18 strains or lines available
References
Original:  J:314153 Chen Z, et al., ELABELA attenuates deoxycorticosterone acetate/salt-induced hypertension and renal injury by inhibition of NADPH oxidase/ROS/NLRP3 inflammasome pathway. Cell Death Dis. 2020 Aug 22;11(8):698
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory