Csf1r^em1Prdns
Endonuclease-mediated Allele Detail

Summary

• Symbol: Csf1r^em1Prdns
• Name: colony stimulating factor 1 receptor; endonuclease-mediated mutation 1, Clare Pridans
• MGI ID: MGI:6833870
• Synonyms: Csf1r^deltaFIRE
• Gene: Csf1r Location: Chr18:61238644-61264211 bp, + strand Genetic Position: Chr18, 34.41 cM, cytoband D
• Alliance: Csf1r^em1Prdns page

Mutation origin

• Strain of Origin: (C57BL/6J x CBA/J)F1

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: Guide RNAs (equivalent to GAGTCCCTCAGTGTGTGAGA and CAATGAGTCTGTACTGGAGC) were designed to introduce a 418 bp deletion in intron 2, which includes the fms-intronic regulatory element (FIRE). (J:281171)

Expression

In Mice Carrying this Mutation:

5 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Csf1r Mutation: 70 strains or lines available

References

• Original: J:281171 Rojo R, et al., Deletion of a Csf1r enhancer selectively impacts CSF1R expression and development of tissue macrophage populations. Nat Commun. 2019 Jul 19;10(1):3215
• All: 15 reference(s)