About   Help   FAQ
Csf1rem1Prdns
Endonuclease-mediated Allele Detail
Summary
Symbol: Csf1rem1Prdns
Name: colony stimulating factor 1 receptor; endonuclease-mediated mutation 1, Clare Pridans
MGI ID: MGI:6833870
Synonyms: Csf1rdeltaFIRE
Gene: Csf1r  Location: Chr18:61238644-61264211 bp, + strand  Genetic Position: Chr18, 34.41 cM, cytoband D
Alliance: Csf1rem1Prdns page
Mutation
origin
Strain of Origin:  (C57BL/6J x CBA/J)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intragenic deletion
 
Mutation detailsGuide RNAs (equivalent to GAGTCCCTCAGTGTGTGAGA and CAATGAGTCTGTACTGGAGC) were designed to introduce a 418 bp deletion in intron 2, which includes the fms-intronic regulatory element (FIRE). (J:281171)
Expression
In Mice Carrying this Mutation: 5 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Csf1r Mutation:  70 strains or lines available
References
Original:  J:281171 Rojo R, et al., Deletion of a Csf1r enhancer selectively impacts CSF1R expression and development of tissue macrophage populations. Nat Commun. 2019 Jul 19;10(1):3215
All:  15 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory