About   Help   FAQ
Ghrem1Liang
Endonuclease-mediated Allele Detail
Summary
Symbol: Ghrem1Liang
Name: growth hormone receptor; endonuclease-mediated mutation 1, Gousheng Liang
MGI ID: MGI:6830928
Synonyms: Ghrf
Gene: Ghr  Location: Chr15:3347237-3612834 bp, - strand  Genetic Position: Chr15, 1.84 cM
Alliance: Ghrem1Liang page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready)
Mutation:    Insertion
 
Mutation detailsUsing CRISPR/cas9 genome editing, guide RNAs (TACAAGTGGGAATTAATCTG and ACCCATCTTCTAGTTATGAA) and oligo donor DNAs are designed to introduce a loxP sites flanking exons 4a and 4b. (J:274377)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ghr Mutation:  52 strains or lines available
References
Original:  J:274377 Fang F, et al., Growth hormone acts on liver to stimulate autophagy, support glucose production, and preserve blood glucose in chronically starved mice. Proc Natl Acad Sci U S A. 2019 Apr 9;116(15):7449-7454
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory