Stat1^em#Ast
Endonuclease-mediated Allele Detail

Summary

• Symbol: Stat1^em#Ast
• Name: signal transducer and activator of transcription 1; endonuclease-mediated mutation, Andreas Strasser
• MGI ID: MGI:6825759
• Gene: Stat1 Location: Chr1:52158599-52201024 bp, + strand Genetic Position: Chr1, 26.81 cM
• Alliance: Stat1^em#Ast page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology using sgRNAs AGGCTAGAGCCTTGTCACGG and GCGAATTGCTAATAAAACA deleted exon 1. Four alleles without indels were generated. The pound symbol (#) is used when line is not specified and/or lines are pooled. (J:272415)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Stat1 Mutation: 73 strains or lines available

References

• Original: J:272415 O'Reilly LA, et al., Loss of NF-kappaB1 Causes Gastric Cancer with Aberrant Inflammation and Expression of Immune Checkpoint Regulators in a STAT-1-Dependent Manner. Immunity. 2018 Mar 20;48(3):570-583.e8
• All: 2 reference(s)