About   Help   FAQ
Cbln1osem1Xis
Endonuclease-mediated Allele Detail
Summary
Symbol: Cbln1osem1Xis
Name: cerebellin 1 precursor protein opposite strand; endonuclease-mediated mutation 1, Xiaoyuan Song
MGI ID: MGI:6798141
Synonyms: Synage KO
Gene: Cbln1os  Location: Chr8:88199440-88252182 bp, + strand  Genetic Position: Chr8, 42.16 cM
Alliance: Cbln1osem1Xis page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThe first and last exons were targeted with sgRNAs (targeting TCCGGCCGGGAGTCAGACGA and AAGGGCATGGTGGGTTGGCG ) using CRISPR/Cas9 technology, resulting in a 52579 bp deletion encompassing most of the gene. Absence of transcription from this allele was confirmed by RT-qPCR. (J:310647)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Cbln1os Mutation:  0 strains or lines available
References
Original:  J:310647 Wang F, et al., The long noncoding RNA Synage regulates synapse stability and neuronal function in the cerebellum. Cell Death Differ. 2021 Sep;28(9):2634-2650
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory