Cbln1os^em1Xis
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cbln1os^em1Xis
• Name: cerebellin 1 precursor protein opposite strand; endonuclease-mediated mutation 1, Xiaoyuan Song
• MGI ID: MGI:6798141
• Synonyms: Synage KO
• Gene: Cbln1os Location: Chr8:88199440-88252182 bp, + strand Genetic Position: Chr8, 42.16 cM
• Alliance: Cbln1os^em1Xis page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: The first and last exons were targeted with sgRNAs (targeting TCCGGCCGGGAGTCAGACGA and AAGGGCATGGTGGGTTGGCG ) using CRISPR/Cas9 technology, resulting in a 52579 bp deletion encompassing most of the gene. Absence of transcription from this allele was confirmed by RT-qPCR. (J:310647)

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cbln1os Mutation: 2 strains or lines available

References

• Original: J:310647 Wang F, et al., The long noncoding RNA Synage regulates synapse stability and neuronal function in the cerebellum. Cell Death Differ. 2021 Sep;28(9):2634-2650
• All: 1 reference(s)