Mob4em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Mob4em1(IMPC)J |
| Name: |
MOB family member 4, phocein; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6794050 |
| Synonyms: |
Mob4- |
| Gene: |
Mob4 Location: Chr1:55170404-55194058 bp, + strand Genetic Position: Chr1, 28.03 cM, cytoband C1
|
| Alliance: |
Mob4em1(IMPC)J page
|
| IMPC: |
Mob4 gene page |
|
Mob4em1(IMPC)J/Mob4em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos are smaller and form a rudimentary egg cylinder but no primitive streak or hallmarks of gastrulation are seen at E7.5.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCACATTAACCGTGTATATG and TCTTCAGGAGATAAGCCCTT, which resulted in an 821 bp deletion beginning at Chromosome 1 position 55,187,235 bp and ending after 55,188,055 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001214175 (exon 4) and 778 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 75 and early truncation 10 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
5 reference(s) |
|