About   Help   FAQ
Celf5em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Celf5em1(IMPC)J
Name: CUGBP, Elav-like family member 5; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6794034
Gene: Celf5  Location: Chr10:81295061-81318543 bp, - strand  Genetic Position: Chr10, 39.72 cM
Alliance: Celf5em1(IMPC)J page
IMPC: Celf5 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAGCTTGTGGCAGTAACAC and TGTCCACGAGTGGCAATCAA, which resulted in a 358 bp deletion beginning at Chromosome 10 position 81,305,085 bp and ending after 81,305,442 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001294357 (exon 5) and 278 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 137 and early truncation 13 amino acids later. There is a 2bp insertion (AG) at the deletion site. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Celf5 Mutation:  26 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory