Celf5^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Celf5^em1(IMPC)J
• Name: CUGBP, Elav-like family member 5; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6794034
• Gene: Celf5 Location: Chr10:81295061-81318543 bp, - strand Genetic Position: Chr10, 39.72 cM
• Alliance: Celf5^em1(IMPC)J page
• IMPC: Celf5 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAGCTTGTGGCAGTAACAC and TGTCCACGAGTGGCAATCAA, which resulted in a 358 bp deletion beginning at Chromosome 10 position 81,305,085 bp and ending after 81,305,442 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001294357 (exon 5) and 278 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 137 and early truncation 13 amino acids later. There is a 2bp insertion (AG) at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Celf5 Mutation: 26 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)