About   Help   FAQ
Ercc6l2em3Mengf
Endonuclease-mediated Allele Detail
Summary
Symbol: Ercc6l2em3Mengf
Name: excision repair cross-complementing rodent repair deficiency, complementation group 6 like 2; endonuclease-mediated mutation 3, Feilong Meng
MGI ID: MGI:6792080
Synonyms: Ercc6l2-HA
Gene: Ercc6l2  Location: Chr13:63963054-64048116 bp, + strand  Genetic Position: Chr13, 33.1 cM, cytoband B3
Alliance: Ercc6l2em3Mengf page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Epitope tag)
Mutation:    Insertion
 
Mutation detailsHA tag sequences were inserted in-frame with the CDS upstream of the stop codon using an sgRNA (targeting TACAGAGAGAGAGTAGGACA) and an ssODN template with CRISPR/Cas9 technology. (J:311900)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Ercc6l2 Mutation:  38 strains or lines available
References
Original:  J:311900 Liu X, et al., ERCC6L2 promotes DNA orientation-specific recombination in mammalian cells. Cell Res. 2020 Sep;30(9):732-744
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory