Ercc6l2^em3Mengf
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ercc6l2^em3Mengf
• Name: excision repair cross-complementing rodent repair deficiency, complementation group 6 like 2; endonuclease-mediated mutation 3, Feilong Meng
• MGI ID: MGI:6792080
• Synonyms: Ercc6l2-HA
• Gene: Ercc6l2 Location: Chr13:63963054-64048116 bp, + strand Genetic Position: Chr13, 33.1 cM, cytoband B3
• Alliance: Ercc6l2^em3Mengf page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Epitope tag)
• Mutation: Insertion
• Mutation details: HA tag sequences were inserted in-frame with the CDS upstream of the stop codon using an sgRNA (targeting TACAGAGAGAGAGTAGGACA) and an ssODN template with CRISPR/Cas9 technology. (J:311900)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ercc6l2 Mutation: 38 strains or lines available

References

• Original: J:311900 Liu X, et al., ERCC6L2 promotes DNA orientation-specific recombination in mammalian cells. Cell Res. 2020 Sep;30(9):732-744
• All: 1 reference(s)