Wdr62^em2Dng
Endonuclease-mediated Allele Detail

Summary

• Symbol: Wdr62^em2Dng
• Name: WD repeat domain 62; endonuclease-mediated mutation 2, Dominic C H Ng
• MGI ID: MGI:6790658
• Synonyms: WDR62^R439H
• Gene: Wdr62 Location: Chr7:29939563-29979844 bp, - strand Genetic Position: Chr7, 17.34 cM
• Alliance: Wdr62^em2Dng page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Arginine codon 439 (CGC) wast targeted for change to a histidine codon (CAC)(c.1316G>A, p.R439H) with an sgRNA and an ssODN template (ACCAGAGAGCTTGCCTGCCGTCCGGGACTTTTCTGACTTGTTCCTCAGACAATACCATCCACTTCTGGAATTTGGATAGCGCCTCTGACACTCGATGGCAAAAGAACATCTTCAGCGATGT ) using CRISPR/Cas9 technology. The mutation mimics the p.R438H mutation found in some patients presenting with microcephaly or cortical malformations. (J:285212)

Expression

In Mice Carrying this Mutation:

13 assay results

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Wdr62 Mutation: 47 strains or lines available

References

• Original: J:285212 Shohayeb B, et al., The association of microcephaly protein WDR62 with CPAP/IFT88 is required for cilia formation and neocortical development. Hum Mol Genet. 2020 Jan 15;29(2):248-263
• All: 2 reference(s)