About   Help   FAQ
Wdr62em1Dng
Endonuclease-mediated Allele Detail
Summary
Symbol: Wdr62em1Dng
Name: WD repeat domain 62; endonuclease-mediated mutation 1, Dominic C H Ng
MGI ID: MGI:6790657
Synonyms: WDR62V66M
Gene: Wdr62  Location: Chr7:29939563-29979844 bp, - strand  Genetic Position: Chr7, 17.34 cM
Alliance: Wdr62em1Dng page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsValine codon 66 (GTG) wast targeted for change to a methionine codon (ATG)(c.196G>A, p.V66M) with an sgRNA and an ssODN template (GAGCTGCTGGAGCAAATATTTTTCTGACAGCCCTTTTCTTTGCAGGTGACACTTGAGAAGATGCTTGGCATCACAGCCCAGAACAGCAGCGGGCTAACCTGTGACCCTGGCACAGGCCATG) using CRISPR/Cas9 technology. The mutation mimics the p.V65M mutation found in some patients presenting with microcephaly or cortical malformations. (J:285212)
Expression
In Mice Carrying this Mutation: 13 assay results
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Wdr62 Mutation:  47 strains or lines available
References
Original:  J:285212 Shohayeb B, et al., The association of microcephaly protein WDR62 with CPAP/IFT88 is required for cilia formation and neocortical development. Hum Mol Genet. 2020 Jan 15;29(2):248-263
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory