About   Help   FAQ
Nlrp3em1Ronz
Endonuclease-mediated Allele Detail
Summary
Symbol: Nlrp3em1Ronz
Name: NLR family, pyrin domain containing 3; endonuclease-mediated mutation 1, Rongbin Zhou
MGI ID: MGI:6790458
Synonyms: Nlrp3Y30E
Gene: Nlrp3  Location: Chr11:59432395-59457781 bp, + strand  Genetic Position: Chr11, 37.73 cM, cytoband B1.3
Alliance: Nlrp3em1Ronz page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Nucleotide substitutions
 
Mutation detailsTyrosine codon 30 (TAC) was targeted for change to glutamic acid (GAA)(p.Y30E) with an sgRNA (targeting GAAGATTACCCGCCCGAGAA) and an ssODN template (CAGTATCTAGAGGACCTTGAAGATGTGGACCTCAAGAAATTCAAAATGCATTTGGAAGATGAACCGCCCGAGAAAGGCTGTATCCCAGTCCCCAGGGGCCAGATGGAGAAGGCAGATCACTTG) using CRISPR/Cas9 technology. The mutation mimics phosphorylation at that residue in the encoded peptide. (J:291770)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Nlrp3 Mutation:  69 strains or lines available
References
Original:  J:291770 Huang Y, et al., Myeloid PTEN promotes chemotherapy-induced NLRP3-inflammasome activation and antitumour immunity. Nat Cell Biol. 2020 Jun;22(6):716-727
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory