Col3a1^em1Hcd
Endonuclease-mediated Allele Detail

Summary

• Symbol: Col3a1^em1Hcd
• Name: collagen, type III, alpha 1; endonuclease-mediated mutation 1, Harry C Dietz
• MGI ID: MGI:6790429
• Synonyms: Col3a1^G209S
• Gene: Col3a1 Location: Chr1:45350698-45388866 bp, + strand Genetic Position: Chr1, 23.67 cM
• Alliance: Col3a1^em1Hcd page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: CRISPR/cas9 guide RNA sequences (CCTGGTGAACCTGGTCAAGC and CCAGGGGGACCTTGGTATC) are targeted to exon 7 to introduce a glycine to serine substitution in amino acid 209 (G209S; nucleotide change GGT to TCT). The mutation is located at the beginning of the triple helical collagenous domain. This mutation is analogous to one found in Vascular Ehlers-Danlos syndrome (vEDS) patients. (J:312454)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Col3a1 Mutation: 85 strains or lines available

References

• Original: J:312454 Bowen CJ, et al., Targetable cellular signaling events mediate vascular pathology in vascular Ehlers-Danlos syndrome. J Clin Invest. 2020 Feb 3;130(2):686-698
• All: 1 reference(s)