Dll1^em1Yoku
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dll1^em1Yoku
• Name: delta like canonical Notch ligand 1; endonuclease-mediated mutation 1, Yusuke Okubo
• MGI ID: MGI:6784011
• Synonyms: Dll1^em1Kann, NC-Dll1
• Gene: Dll1 Location: Chr17:15587616-15597134 bp, - strand Genetic Position: Chr17, 8.95 cM
• Alliance: Dll1^em1Yoku page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology generated a 48 bp deletion (CCCATGGTGGTGGACCTCAGTGAGAGGCATATGGAGAGCCAGGGCGGG) of essential sequence for cleavage of the protein and production of the Delta like 1 intracelluar domain. (J:311929)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Dll1 Mutation: 46 strains or lines available

References

• Original: J:311929 Okubo Y, et al., Cleaved Delta like 1 intracellular domain regulates neural development via Notch signal-dependent and -independent pathways. Development. 2021 Oct 1;148(19):dev193664
• All: 1 reference(s)