About   Help   FAQ
Pik3r1em1Mahm
Endonuclease-mediated Allele Detail
Summary
Symbol: Pik3r1em1Mahm
Name: phosphoinositide-3-kinase regulatory subunit 1; endonuclease-mediated mutation 1, Mahtab Moayeri
MGI ID: MGI:6783455
Synonyms: Pik3r1GVAA
Gene: Pik3r1  Location: Chr13:101817269-101904725 bp, - strand  Genetic Position: Chr13, 53.92 cM
Alliance: Pik3r1em1Mahm page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Nucleotide substitutions
 
Mutation detailsProline and arginine (PPRP) codons 91-94 (CCCCCTCGACCG) in exon 2 were targeted for change to glycine-valine-alanine-alanine (GGTGTAGCAGCT)(p.P91_P94delinsGVAA)) with two sgRNAs (targeting GAGCAACAGGAAGCGGTCGA and TTTGAAGAACCCGGAGCAAC) and an ssODN template (GCTACAATGAAACCACTGGGGAGAGGGGAGACTTTCCAGGAACTTACGTTGAATACATTGGAAGGAAAAGAATTTCACCCCCTACTCCCAAGCCTCGGGGTGTAGCAGCTCTTCCTGTTGCTCCGGGTTCTTCAAAAACTGAAGCTGACACGGAGCAGCAAGGTCAGTATGATGAGTGGCTGGTTACTTAATGACCTTTT) using CRISPR/Cas9 technology. The mutation renders the encoded peptide more resistant to cleavage by anthrax lethal toxin. (J:304170)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Pik3r1 Mutation:  53 strains or lines available
References
Original:  J:304170 Mendenhall MA, et al., Anthrax lethal factor cleaves regulatory subunits of phosphoinositide-3 kinase to contribute to toxin lethality. Nat Microbiol. 2020 Dec;5(12):1464-1471
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory