Pik3r1^em1Mahm
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pik3r1^em1Mahm
• Name: phosphoinositide-3-kinase regulatory subunit 1; endonuclease-mediated mutation 1, Mahtab Moayeri
• MGI ID: MGI:6783455
• Synonyms: Pik3r1^GVAA
• Gene: Pik3r1 Location: Chr13:101817269-101904725 bp, - strand Genetic Position: Chr13, 53.92 cM
• Alliance: Pik3r1^em1Mahm page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Nucleotide substitutions
• Mutation details: Proline and arginine (PPRP) codons 91-94 (CCCCCTCGACCG) in exon 2 were targeted for change to glycine-valine-alanine-alanine (GGTGTAGCAGCT)(p.P91_P94delinsGVAA)) with two sgRNAs (targeting GAGCAACAGGAAGCGGTCGA and TTTGAAGAACCCGGAGCAAC) and an ssODN template (GCTACAATGAAACCACTGGGGAGAGGGGAGACTTTCCAGGAACTTACGTTGAATACATTGGAAGGAAAAGAATTTCACCCCCTACTCCCAAGCCTCGGGGTGTAGCAGCTCTTCCTGTTGCTCCGGGTTCTTCAAAAACTGAAGCTGACACGGAGCAGCAAGGTCAGTATGATGAGTGGCTGGTTACTTAATGACCTTTT) using CRISPR/Cas9 technology. The mutation renders the encoded peptide more resistant to cleavage by anthrax lethal toxin. (J:304170)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pik3r1 Mutation: 53 strains or lines available

References

• Original: J:304170 Mendenhall MA, et al., Anthrax lethal factor cleaves regulatory subunits of phosphoinositide-3 kinase to contribute to toxin lethality. Nat Microbiol. 2020 Dec;5(12):1464-1471
• All: 1 reference(s)