About   Help   FAQ
Elovl2em1Haml
Endonuclease-mediated Allele Detail
Summary
Symbol: Elovl2em1Haml
Name: ELOVL fatty acid elongase 2; endonuclease-mediated mutation 1, Bruce Hamilton
MGI ID: MGI:6782853
Synonyms: Elovl2C234W
Gene: Elovl2  Location: Chr13:41335858-41373879 bp, - strand  Genetic Position: Chr13, 20.38 cM
Alliance: Elovl2em1Haml page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Single point mutation
 
Mutation detailsCysteine codon 234 (TGT) was targeted for change to a tryptophan codon (TGG)(p.C234W) with an sgRNA (targeting GTCTTCCTATATGATGACGC) and an ssODN template (TTTCCCTTCGGCTGGCTCATCTTCCAGTCTTCCTATATGATGACGTTAGTC). The mutation selectively abolishes the enzymatic activity needed to process C22 polyunsaturated fatty acids, while leaving other enzymatic activity intact. (J:284063)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Elovl2 Mutation:  13 strains or lines available
References
Original:  J:284063 Chen D, et al., The lipid elongation enzyme ELOVL2 is a molecular regulator of aging in the retina. Aging Cell. 2020 Feb;19(2):e13100
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory