Pten^em1Miii
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pten^em1Miii
• Name: phosphatase and tensin homolog; endonuclease-mediated mutation 1, Miho Iijima
• MGI ID: MGI:6781825
• Synonyms: PTEN^{K13R, D384V}
• Gene: Pten Location: Chr19:32734977-32803560 bp, + strand Genetic Position: Chr19, 28.14 cM
• Alliance: Pten^em1Miii page

Mutation origin

• Strain of Origin: (C57BL/6 x SJL)F1

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Codons K13 (AAA) and D384 (GAC) were targeted for change to arginine (AGA)(p.K13R) and valine (GTG)(p.D384V) by sgRNAs (targeting AGATCGTTAGCAGAAACAAA and ATTCTCTGGATCAGAGTCAG) and ssODN templates (TTCTTCAGCCACAGGCTCCCAGACATGACAGCCATCATCAAAGAGATCGTTAGCAGAAACAGAAGGAGATATCAAGAGGATGGATTCGACTTAGACTTGACCTGTATCCATTTCTGCGGCTGT and ATCAGACTTTTGTAATTTGTGAATGCTGATCTTCATCAAAAGGTTCATTCTCTGGATCAGCGTCAGCGGCGTCAGCATATCTATAATGATCAGGTTCATTGTCACTAACATCTGGAGTCACAGAAGTTGAACTGCT) using CRISPR/Cas9 technology. The lysine-to-arginine mutation prevents ubiquination of the residue and thus nuclear localization of the peptide. The aspartic acid-to-valine mutation interferes with the phosphorylation of the C-terminal tail of the peptide. (J:264011)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pten Mutation: 86 strains or lines available

References

• Original: J:264011 Igarashi A, et al., Nuclear PTEN deficiency causes microcephaly with decreased neuronal soma size and increased seizure susceptibility. J Biol Chem. 2018 Jun 15;293(24):9292-9300
• All: 3 reference(s)