Casp8^em2Dgre
Endonuclease-mediated Allele Detail

Summary

• Symbol: Casp8^em2Dgre
• Name: caspase 8; endonuclease-mediated mutation 2, Douglas R Green
• MGI ID: MGI:6781657
• Synonyms: Casp8^F122GL123G
• Gene: Casp8 Location: Chr1:58834553-58886663 bp, + strand Genetic Position: Chr1, 29.19 cM, cytoband B
• Alliance: Casp8^em2Dgre page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Phenylalanine and leucine codons 122 (TTC) and 123 (CTT) were targeted for change to glycine codons (GGT)(p.F122_L123delinsGG) with an sgRNA (targeting TAATACGACTCACTATAGGTGGGGATCTCATTGTTCAAAGTTTTAGAGCTAGAAATAGCA) and an ssODN template (GTTTCCTGCCACAGGGTCATGCTCTTTAAGCTCTCAGAAGAAGTGAGCGAGTTGGAATTGAGATCTTTTAAAGGTGGTTTGAACAATGAGATCCCCAAATGTAAGCTGGAAGATGACTTGGTAAGACCTAATCTCCTGAAGATGGGTCACCTCTGG) using CRISPR/Cas9 technology. These mutations create an oligomerization-deficient form of the encoded peptide. (J:296046)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Casp8 Mutation: 45 strains or lines available

References

• Original: J:296046 Tummers B, et al., Caspase-8-Dependent Inflammatory Responses Are Controlled by Its Adaptor, FADD, and Necroptosis. Immunity. 2020 Jun 16;52(6):994-1006.e8
• All: 1 reference(s)