Srsf7^em1Mmri
Endonuclease-mediated Allele Detail

Summary

• Symbol: Srsf7^em1Mmri
• Name: serine and arginine-rich splicing factor 7; endonuclease-mediated mutation 1, Masaki Mori
• MGI ID: MGI:6781649
• Synonyms: Srsf7^fs
• Gene: Srsf7 Location: Chr17:80507509-80514734 bp, - strand Genetic Position: Chr17, 50.63 cM
• Alliance: Srsf7^em1Mmri page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Single point mutation
• Mutation details: CRISPR/cas9 mediated recombination using the guide RNA GGCAATCCACACAGTTCTTAAGG introduce a single nucleotide insertion of an A in exon 2. (J:311518)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Srsf7 Mutation: 14 strains or lines available

References

• Original: J:311518 Kadota Y, et al., Srsf7 Establishes the Juvenile Transcriptome through Age-Dependent Alternative Splicing in Mice. iScience. 2020 Mar 27;23(3):100929
• All: 1 reference(s)