Xrcc6^em1Anjd
Endonuclease-mediated Allele Detail

Summary

• Symbol: Xrcc6^em1Anjd
• Name: X-ray repair cross complementing 6; endonuclease-mediated mutation 1, Anthony J Davis
• MGI ID: MGI:6780001
• Synonyms: Ku70^3A
• Gene: Xrcc6 Location: Chr15:81872036-81924286 bp, + strand Genetic Position: Chr15, 38.33 cM, cytoband E-F
• Alliance: Xrcc6^em1Anjd page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Threonine codons 305 and 314 and serine codon 312 were targeted for change to alanine (p.T305A, p.S312A, p.T314A) with a gRNA (targeting ACACCAAGCGGTCTCTGGTAGG) and an ssODN (GAACCAGTGAAAACCAAGACAAGGACTTTTAATGTAAACGCCGGCAGTCTACTCCTGCCTGCTGACGCCAAGCGGTCTCTGGTAGGTGGCTAACCTTTCCTACCGAATCTTGTTTAAGA) using CRISPR/Cas9 technology. These mutations make the encoded amino acids unphosphorylatable. (J:310821)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Xrcc6 Mutation: 64 strains or lines available

References

• Original: J:310821 Saha J, et al., Ablating putative Ku70 phosphorylation sites results in defective DNA damage repair and spontaneous induction of hepatocellular carcinoma. Nucleic Acids Res. 2021 Sep 27;49(17):9836-9850
• All: 1 reference(s)