About   Help   FAQ
Nbnem6Jpt
Endonuclease-mediated Allele Detail
Summary
Symbol: Nbnem6Jpt
Name: nibrin; endonuclease-mediated mutation 6, John H Petrini
MGI ID: MGI:6771584
Synonyms: Nbs1mid7c
Gene: Nbn  Location: Chr4:15957925-15992589 bp, + strand  Genetic Position: Chr4, 6.66 cM, cytoband A
Alliance: Nbnem6Jpt page
Mutation
origin
Strain of Origin:  Not Specified
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutations:    Insertion, Intragenic deletion
 
Mutation details

TALEN-mediated genome-editing generated an insertion of TTTTTTATAATATAAAATAAG replacing CTGAAGAATTT in the Mre11 interacting domain of exon 13 (a total of 10 bp insertion) resulting in a stop codon and truncated protein. (J:251434)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Nbn Mutation:  61 strains or lines available
References
Original:  J:251434 Kim JH, et al., The Mre11-Nbs1 Interface Is Essential for Viability and Tumor Suppression. Cell Rep. 2017 Jan 10;18(2):496-507
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory