Klrc2^em1Sigal
Endonuclease-mediated Allele Detail

Summary

• Symbol: Klrc2^em1Sigal
• Name: killer cell lectin-like receptor subfamily C, member 2; endonuclease-mediated mutation 1, Luis Sigal
• MGI ID: MGI:6771527
• Gene: Klrc2 Location: Chr6:129626565-129637700 bp, - strand Genetic Position: Chr6, 63.44 cM
• Alliance: Klrc2^em1Sigal page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Guide RNA (AATCTTGGAATGACAGTTTG) created a GA insertion by non-homologous end joining (NHEJ) after position 438 in exon 3, resulting in an early termination codon 40 bp downstream. (J:311543)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Klrc2 Mutation: 18 strains or lines available

References

• Original: J:311543 Ferez M, et al., Viral infection modulates Qa-1b in infected and bystander cells to properly direct NK cell killing. J Exp Med. 2021 May 3;218(5)
• All: 1 reference(s)