Chmp1b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Chmp1b^em1(IMPC)J
• Name: charged multivesicular body protein 1B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6764592
• Gene: Chmp1b Location: Chr18:67338437-67340960 bp, + strand Genetic Position: Chr18, 39.89 cM, cytoband E1
• Alliance: Chmp1b^em1(IMPC)J page
• IMPC: Chmp1b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAACAGATGCTTCTCCATGT and GCCGTCAGACTTGATCCCGA, which resulted in a 583 bp deletion beginning at Chromosome 18 position 67,338,578 bp and ending after 67,339,160 bp (GRCm39/mm39). This mutation deletes 583 bp from ENSMUSE00001382908 (exon 1) and is predicted to cause a change of amino acid sequence after residue 2 and early truncation 19 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Chmp1b Mutation: 6 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)