About   Help   FAQ
Chmp1bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Chmp1bem1(IMPC)J
Name: charged multivesicular body protein 1B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6764592
Gene: Chmp1b  Location: Chr18:67338437-67340960 bp, + strand  Genetic Position: Chr18, 39.89 cM, cytoband E1
Alliance: Chmp1bem1(IMPC)J page
IMPC: Chmp1b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAACAGATGCTTCTCCATGT and GCCGTCAGACTTGATCCCGA, which resulted in a 583 bp deletion beginning at Chromosome 18 position 67,338,578 bp and ending after 67,339,160 bp (GRCm39/mm39). This mutation deletes 583 bp from ENSMUSE00001382908 (exon 1) and is predicted to cause a change of amino acid sequence after residue 2 and early truncation 19 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Chmp1b Mutation:  6 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory