Fbrs^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fbrs^em1(IMPC)J
• Name: fibrosin; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6764589
• Gene: Fbrs Location: Chr7:127078371-127090883 bp, + strand Genetic Position: Chr7, 69.55 cM, cytoband F4
• Alliance: Fbrs^em1(IMPC)J page
• IMPC: Fbrs gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCGAGACCGGATTCTCTGCA and AACCTTCTACTCCCATGCCG, which resulted in a 1748 bp deletion beginning at Chromosome 7 position 127,083,557 bp and ending after 127,085,304 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001370970, ENSMUSE00001372570, ENSMUSE00000890591, ENSMUSE00000632361, and ENSMUSE00000632360 (exons 7-11) and 1036 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 347 and early truncation 9 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Fbrs Mutation: 23 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)