About   Help   FAQ
Rps21em2Utr
Endonuclease-mediated Allele Detail
Summary
Symbol: Rps21em2Utr
Name: ribosomal protein S21; endonuclease-mediated mutation 2, University of Tsukuba Laboratory Animal Resource Center
MGI ID: MGI:6761757
Synonyms: Rps21indel
Gene: Rps21  Location: Chr2:179899172-179900237 bp, + strand  Genetic Position: Chr2, 102.78 cM
Alliance: Rps21em2Utr page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation details

CRISPR-targeting using an sgRNA targeting CCGAGGTGAGCTGGGAACCTGAC in exon 3 produced an indel that results in a frameshift and premature termination. (J:309963)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rps21 Mutation:  10 strains or lines available
References
Original:  J:309963 Dinh TTH, et al., Disruption of entire Cables2 locus leads to embryonic lethality by diminished Rps21 gene expression and enhanced p53 pathway. Elife. 2021 May 5;10:e50346
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory