About   Help   FAQ
Zfp541em1Osb
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp541em1Osb
Name: zinc finger protein 541; endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University
MGI ID: MGI:6758830
Synonyms: Zfp541em1Maik, Zfp541 KO
Gene: Zfp541  Location: Chr7:15795739-15830259 bp, + strand  Genetic Position: Chr7, 8.74 cM
Alliance: Zfp541em1Osb page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:306305
Parent Cell Line:  EGR-G01 (ES Cell)
Strain of Origin:  (129S2/SvPas x C57BL/6NSlc)F1-Tg(CAG-EGFP,Acr-EGFP)2Osb
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsSequence upstream of exon 1 and in intron 8 were targeted with a pair of sgRNAs (targeting (1) TCCACTTCTCTAGTGCTAGG and (3) AGGCAGCTACACCACCCTCC), resulting in the deletion between sgRNA targets 1 and 3 containing exons 1-8. The ESCs used for the creation of this allele also contain the Tg(CAG-EGFP,Acr-EGFP)2Osb double transgene. (J:306305)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp541 Mutation:  48 strains or lines available
References
Original:  J:306305 Oura S, et al., KCTD19 and its associated protein ZFP541 are independently essential for meiosis in male mice. PLoS Genet. 2021 May;17(5):e1009412
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/16/2024
MGI 6.23
The Jackson Laboratory