About   Help   FAQ
Kctd19em1Osb
Endonuclease-mediated Allele Detail
Summary
Symbol: Kctd19em1Osb
Name: potassium channel tetramerisation domain containing 19; endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University
MGI ID: MGI:6758821
Synonyms: Kctd19del, Kctd19em1Maik
Gene: Kctd19  Location: Chr8:106109439-106140134 bp, - strand  Genetic Position: Chr8, 53.04 cM
Alliance: Kctd19em1Osb page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsExons 3 and 13 (or 12, depending on splice variant) were targeted with two sgRNAs (targeting TCCATGTCCGCCAGTAGTTC and AAAAAGAGCTATTACCCTAA) and tracrRNAs and crRNA using CRISPR/Cas9 technology, resulting in a 9620 bp deletion from the 3' end of exon 3 to the 5' end of exon 13 (12). Immunoblots confirmed the absence of peptide expression from this allele. (J:306305)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 18 assay results
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 6 strains available      Cell Lines: 0 lines available
Carrying any Kctd19 Mutation:  52 strains or lines available
References
Original:  J:306305 Oura S, et al., KCTD19 and its associated protein ZFP541 are independently essential for meiosis in male mice. PLoS Genet. 2021 May;17(5):e1009412
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory