About   Help   FAQ
Rr180em1Geny
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr180em1Geny
Name: regulatory region 180; endonuclease-mediated mutation 1, Gen Yamada
MGI ID: MGI:6756420
Synonyms: MafBedelta, Mafbem1Geny
Gene: Rr180  Location: Chr2:160206552-160207620 bp  Genetic Position: Chr2, Syntenic
Alliance: Rr180em1Geny page
Mutation
origin
Strain of Origin:  C57BL/6 x DBA/2
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intragenic deletion
 
Mutation detailsThe H3K27ac regulatory (enhancer) element of the embryonic external genitalia (eExG) enhancer in the 3' UTR of Mafb was targeted with gRNAs (targeting TCTGTGAGTCCTGGCGGGTCCGG and TGCCGAGATCCACATCGTGCA) using CRISPR/Cas9 technology, resulting in a 1068 bp deletion. (J:306453)
Expression
In Mice Carrying this Mutation: 4 assay results
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr180 Mutation:  0 strains or lines available
References
Original:  J:306453 Kajioka D, et al., Sexual fate of murine external genitalia development: Conserved transcriptional competency for male-biased genes in both sexes. Proc Natl Acad Sci U S A. 2021 Jun 8;118(23):e2024067118
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory