Rr180^em1Geny
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr180^em1Geny
• Name: regulatory region 180; endonuclease-mediated mutation 1, Gen Yamada
• MGI ID: MGI:6756420
• Synonyms: MafB^edelta, Mafb^em1Geny
• Gene: Rr180 Location: Chr2:160206552-160207620 bp Genetic Position: Chr2, Syntenic
• Alliance: Rr180^em1Geny page

Mutation origin

• Strain of Origin: C57BL/6 x DBA/2

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: The H3K27ac regulatory (enhancer) element of the embryonic external genitalia (eExG) enhancer in the 3' UTR of Mafb was targeted with gRNAs (targeting TCTGTGAGTCCTGGCGGGTCCGG and TGCCGAGATCCACATCGTGCA) using CRISPR/Cas9 technology, resulting in a 1068 bp deletion. (J:306453)

Expression

In Mice Carrying this Mutation:

4 assay results

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr180 Mutation: 0 strains or lines available

References

• Original: J:306453 Kajioka D, et al., Sexual fate of murine external genitalia development: Conserved transcriptional competency for male-biased genes in both sexes. Proc Natl Acad Sci U S A. 2021 Jun 8;118(23):e2024067118
• All: 1 reference(s)