Tlr3^em1Yph
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tlr3^em1Yph
• Name: toll-like receptor 3; endonuclease-mediated mutation 1, Yi-Ping Hsueh
• MGI ID: MGI:6756347
• Synonyms: Tlr3^t
• Gene: Tlr3 Location: Chr8:45848702-45864112 bp, - strand Genetic Position: Chr8, 25.31 cM, cytoband B2
• Alliance: Tlr3^em1Yph page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Epitope tag)
• Mutation: Insertion
• Mutation details: Guide RNA (tgcaagtagcacttggatct) and oligo donor DNA (catgatggacctttataaattggatc tatccctttaccgactccaaatcttcaaatgagtttaAGCGTAATCTGGAACA TCGTATGGGTAaccgttCAGATCCTCTTCTGAGATGAGTT TTTGTTCTCTAGAatgtgctgaattTcTagatccaagtgctacttgcaatt tatgatgaaaggcatttatccgttctttct) were designed to insert a Myc-HA dual tag (and an XbaI restriction site) into exon 7. (J:30988)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tlr3 Mutation: 72 strains or lines available

References

• Original: J:30988 Bogerd AM, et al., Identification and characterization of two upstream elements that regulate adrenocortical expression of steroid 11 beta-hydroxylase. Mol Endocrinol. 1990 Jun;4(6):845-50
• All: 1 reference(s)