About   Help   FAQ
Pdp2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pdp2em1(IMPC)J
Name: pyruvate dehydrogenase phosphatase catalytic subunit 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6755467
Gene: Pdp2  Location: Chr8:105318104-105325658 bp, + strand  Genetic Position: Chr8, 53.04 cM
Alliance: Pdp2em1(IMPC)J page
IMPC: Pdp2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGCAGAATTGAAGATCCAGT and CCATGACAGTGATATCATCC, which resulted in a 1510 bp deletion beginning at Chromosome 8 position 105,320,175 bp and ending after 105,321,684 bp (GRCm39/mm39). This mutation deletes 1510 bp from ENSMUSE00000334359 (exon 2) and is predicted to cause a change of amino acid sequence after residue 7 and termination 41 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Pdp2 Mutation:  14 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory