About   Help   FAQ
Ccdc87em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ccdc87em1(IMPC)J
Name: coiled-coil domain containing 87; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6755465
Gene: Ccdc87  Location: Chr19:4889394-4892556 bp, + strand  Genetic Position: Chr19, 4.11 cM
Alliance: Ccdc87em1(IMPC)J page
IMPC: Ccdc87 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACCTCAAGCCGATTTACCAC and GTGAGTAGTGGGAGTATTCC, which resulted in a 2506 bp deletion beginning at Chromosome 19 position 4,889,552 bp and ending after 4,892,057 bp (GRCm39/mm39). This mutation deletes 2506 bp from ENSMUSE00000553699 (exon 1) coding sequence and is predicted to cause a change of amino acid sequence after residue 14 and termination 22 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ccdc87 Mutation:  28 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory