Zbtb9^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zbtb9^em1(IMPC)J
• Name: zinc finger and BTB domain containing 9; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6755462
• Gene: Zbtb9 Location: Chr17:27192153-27195177 bp, + strand Genetic Position: Chr17, 13.6 cM, cytoband B1
• Alliance: Zbtb9^em1(IMPC)J page
• IMPC: Zbtb9 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAAAGGAGTCGAAGCATCCA and GTAGTCATTTGTAAGTCCAG, which resulted in a 1363 bp deletion beginning at Chromosome 17 position 27,192,601 bp and ending after 27,193,963 bp (GRCm39/mm39). This mutation deletes 1363 bp from ENSMUSE00000716828 (exon 2) coding sequence and is predicted to cause a change of amino acid sequence after residue 1 and termination 16 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Zbtb9 Mutation: 40 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)