Grid1^em1Mpan
Endonuclease-mediated Allele Detail

Summary

• Symbol: Grid1^em1Mpan
• Name: glutamate receptor, ionotropic, delta 1; endonuclease-mediated mutation 1, Matthew Anderson
• MGI ID: MGI:6754124
• Gene: Grid1 Location: Chr14:34542065-35305336 bp, + strand Genetic Position: Chr14, 20.84 cM
• Alliance: Grid1^em1Mpan page

Mutation origin

• Strain of Origin: FVB/NJ

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details: CRISPER/cas9 genome editing used signal guide RNAs (TCCAGCCCCAGGATATAAGG and CGGTTCCTTCACAGACCACG) to introduce loxP sites to surround exon 4. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Grid1 Mutation: 59 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)