About   Help   FAQ
4930579G24Rikem1Qsh
Endonuclease-mediated Allele Detail
Summary
Symbol: 4930579G24Rikem1Qsh
Name: RIKEN cDNA 4930579G24 gene; endonuclease-mediated mutation 1, Qinghua Shi
MGI ID: MGI:6753386
Synonyms: C4orf46-
Gene: 4930579G24Rik  Location: Chr3:79536386-79540127 bp, + strand  Genetic Position: Chr3, 34.93 cM, cytoband F1
Alliance: 4930579G24Rikem1Qsh page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsExon 1 was targeted with two sgRNAs (targeting GTTGGACCGGGACTCCTGCT and CGTGGACCCGCTGGAGCAAG) using CRISPR/Cas9 technology, resulting in a 32 bp deletion (CCCGGTCCAACCGTGGACCCGCTGGAGCAAGT) that causes a frameshift and premature stop codon (p.(Pro44Glyfs*13)). Western blot experiments confirmed the absence of full-length peptides in the testes. (J:307600)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any 4930579G24Rik Mutation:  8 strains or lines available
References
Original:  J:307600 Shah B, et al., Inactivation of testis-specific gene C4orf46 is dispensable for spermatogenesis and fertility in mouse. Mamm Genome. 2021 Jun 2;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory