Mbem1Shad
Endonuclease-mediated Allele Detail
|
Symbol: |
Mbem1Shad |
Name: |
myoglobin; endonuclease-mediated mutation 1, Sean H Adams |
MGI ID: |
MGI:6752552 |
Synonyms: |
Mb- |
Gene: |
Mb Location: Chr15:76899687-76934868 bp, - strand Genetic Position: Chr15, 36.36 cM
|
Alliance: |
Mbem1Shad page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: The gene was targeted with two gRNAs (targeting GAACTTGTCAAACTTATCCA and CGGTGCAACCATGCTTCTTC) using CRISPR/Cas9 technology, leading to a 199 bp deletion that includes the exon 2 splice acceptor and most of exon 2 (chr15:7690182276902020 (GRCm39)) in founder 14. This deletion causes the skipping of exon 2 and splicing of exon 1 to 3, which results in a reading frame shift and premature stop codon.
(J:307655)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Mb Mutation: |
18 strains or lines available
|
|
Original: |
J:307655 Ono-Moore KD, et al., Metabolic physiology and skeletal muscle phenotypes in male and female myoglobin knockout mice. Am J Physiol Endocrinol Metab. 2021 Jul 1;321(1):E63-E79 |
All: |
2 reference(s) |
|