About   Help   FAQ
Mbem1Shad
Endonuclease-mediated Allele Detail
Summary
Symbol: Mbem1Shad
Name: myoglobin; endonuclease-mediated mutation 1, Sean H Adams
MGI ID: MGI:6752552
Synonyms: Mb-
Gene: Mb  Location: Chr15:76899687-76934868 bp, - strand  Genetic Position: Chr15, 36.36 cM
Alliance: Mbem1Shad page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThe gene was targeted with two gRNAs (targeting GAACTTGTCAAACTTATCCA and CGGTGCAACCATGCTTCTTC) using CRISPR/Cas9 technology, leading to a 199 bp deletion that includes the exon 2 splice acceptor and most of exon 2 (chr15:7690182276902020 (GRCm39)) in founder 14. This deletion causes the skipping of exon 2 and splicing of exon 1 to 3, which results in a reading frame shift and premature stop codon. (J:307655)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Mb Mutation:  21 strains or lines available
References
Original:  J:307655 Ono-Moore KD, et al., Metabolic physiology and skeletal muscle phenotypes in male and female myoglobin knockout mice. Am J Physiol Endocrinol Metab. 2021 Jul 1;321(1):E63-E79
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory