About   Help   FAQ
Grnem1(IMPC)H
Endonuclease-mediated Allele Detail
Summary
Symbol: Grnem1(IMPC)H
Name: granulin; endonuclease-mediated mutation 1, Harwell
MGI ID: MGI:6750883
Gene: Grn  Location: Chr11:102321333-102327635 bp, + strand  Genetic Position: Chr11, 66.29 cM
Alliance: Grnem1(IMPC)H page
IMPC: Grn gene page
Mutation
origin
Strain of Origin:  C57BL/6NTac
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Intragenic deletion
 
Mutation details This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences AGATGATGGCTCGTTATTCT and ATAACGAGCCATCATCTAGA that targeted exon(s) ENSMUSE00001278698.2. This resulted in deletion(s) of 20 bp (location: Chr11:102324061-102324080; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Grn Mutation:  53 strains or lines available
References
Original:  J:169366 MouseBookTM, Information obtained from MouseBookTM, Medical Research Council Mammalian Genetics Unit, Harwell, UK. Unpublished. 2005-2013;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/01/2026
MGI 6.24
The Jackson Laboratory