Tmem212em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Tmem212em1(IMPC)J |
Name: |
transmembrane protein 212; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6740211 |
Gene: |
Tmem212 Location: Chr3:27920215-27950517 bp, - strand Genetic Position: Chr3, 11.05 cM
|
Alliance: |
Tmem212em1(IMPC)J page
|
IMPC: |
Tmem212 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutations: |
|
Insertion, Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACGTATGTAGAGGGCACAAC and TCGTGACCTAACAGGAGCGG, which resulted in a 2249 bp deletion plus a 1 base pair insertion (T) beginning at Chromosome 3 position 27,938,683 bp and ending after 27,940,931 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000364670, ENSMUSE00000409111 (exons 2 and 3) and 1866 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 53 and early truncation 14 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|