About   Help   FAQ
Mrgprb1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Mrgprb1em1(IMPC)J
Name: MAS-related GPR, member B1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6740190
Gene: Mrgprb1  Location: Chr7:48093861-48106090 bp, - strand  Genetic Position: Chr7, 31.11 cM
Alliance: Mrgprb1em1(IMPC)J page
IMPC: Mrgprb1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGTCTTCCGTTGAAACCGA and GATTGCACCACTCCTGAAAA, which resulted in a 776 bp deletion beginning at Chromosome 7 position 48,097,004 bp and ending after 48,097,779 bp (GRCm39/mm39). This mutation deletes 776 bp from ENSMUSE00000593974 (exon 2) and is predicted to cause a change of amino acid sequence after residue 44 and termination 15 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Mrgprb1 Mutation:  33 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory