About   Help   FAQ
Arl14em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Arl14em1(IMPC)J
Name: ADP-ribosylation factor-like 14; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6740188
Gene: Arl14  Location: Chr3:69129752-69130951 bp, + strand  Genetic Position: Chr3, 32.2 cM, cytoband E3
Alliance: Arl14em1(IMPC)J page
IMPC: Arl14 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAGTCCGAGGAGAAGAATGT and TTTCTGCTTGAAGATTGCTA, which resulted in a 524 bp deletion beginning at Chromosome 3 position 69,129,897 bp and ending after 69,130,420 bp (GRCm39/mm39). This mutation deletes 524 bp from ENSMUSE00001258649 (exon 1) and is predicted to cause a change of amino acid sequence after residue 14 and termination 6 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Arl14 Mutation:  7 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory