About   Help   FAQ
4930524B15Rikem1Qsh
Endonuclease-mediated Allele Detail
Summary
Symbol: 4930524B15Rikem1Qsh
Name: RIKEN cDNA 4930524B15 gene; endonuclease-mediated mutation 1, Qinghua Shi
MGI ID: MGI:6739918
Synonyms: 4930524B15Rik-
Gene: 4930524B15Rik  Location: Chr11:31915592-31929651 bp, + strand  Genetic Position: Chr11, 18.71 cM, cytoband A4
Alliance: 4930524B15Rikem1Qsh page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Duplication, Insertion
 
Mutation detailsExon 1 of the gene was targeted with sgRNAs (targeting CTCCGAGGTTTCGGCCATCGG and CTGGAAAGGGGCGGAATCCGG) using CRISPR/Cas9 technology, resulting in a one nucleotide insertion (duplication) (A) before/after (of) coding nucleotide 116, causing a frameshift and premature stop codon. (J:308296)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any 4930524B15Rik Mutation:  2 strains or lines available
References
Original:  J:308296 Khan R, et al., Evolutionarily conserved and testis-specific gene, 4930524B15Rik, is not essential for mouse spermatogenesis and fertility. Mol Biol Rep. 2020 Jul;47(7):5207-5213
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory