About   Help   FAQ
Krasem1Bbd
Endonuclease-mediated Allele Detail
Summary
Symbol: Krasem1Bbd
Name: Kras proto-oncogene, GTPase; endonuclease-mediated mutation 1, Mariano Barbacid
MGI ID: MGI:6739818
Synonyms: KRAS4B154
Gene: Kras  Location: Chr6:145162425-145195965 bp, - strand  Genetic Position: Chr6, 77.37 cM, cytoband G2
Alliance: Krasem1Bbd page
Mutation
origin
Strain of Origin:  mixed
Mutation
description
Allele Type:    Endonuclease-mediated (Modified isoform(s))
Mutation:    Nucleotide substitutions
 
Mutation detailsAlanine codon 155 (GCC) in exon 5 was changed to a stop codon (TGA) (p.A155*) using an sgRNA (targeting GGAAGATATGTAATCAGGCTCTT) and an ssODN template with CRISPR/Cas9 technology. (J:308301)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Kras Mutation:  68 strains or lines available
Notes
The guide RNAs were injected into zygotes from a cross of (C57BL/6 x CBA)F1 females with Krastm3Bbd/Kras+;Trp53tm1.1Dgk/Trp53tm1.1Dgk males on a mixed 129/Sv-C57BL/6 genetic background.
References
Original:  J:308301 Salmon M, et al., KRAS4A induces metastatic lung adenocarcinomas in vivo in the absence of the KRAS4B isoform. Proc Natl Acad Sci U S A. 2021 Jul 27;118(30):e2023112118
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory