About   Help   FAQ
Zfp622em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp622em1(IMPC)J
Name: zinc finger protein 622; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6731067
Synonyms: Zfp622-
Gene: Zfp622  Location: Chr15:25984452-25998567 bp, + strand  Genetic Position: Chr15, 9.71 cM
Alliance: Zfp622em1(IMPC)J page
IMPC: Zfp622 gene page
Zfp622em1(IMPC)J/Zfp622em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Embryos at E3.5 appear as dying morulae. Mutants fail to hatch from the zona pellucida and never reach blastocyst stage in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGCATTCCCTGGAATCATT and TCCGTCTGACTCCTTTCCAG, which resulted in a 5037 bp deletion beginning at Chromosome 15 position 25,991,444 bp and ending after 25,996,480 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000562948, ENSMUSE00000562947 (exons 4 and 5) and 4780 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 351 and early truncation 3 amino acids later. (J:188991, J:384794)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp622 Mutation:  20 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/19/2026
MGI 6.24
The Jackson Laboratory