About   Help   FAQ
Del(3Sprr2a1-Sprr2a3)1Lvh
Endonuclease-mediated Allele Detail
Summary
Symbol: Del(3Sprr2a1-Sprr2a3)1Lvh
Name: deletion, chr 3, Lora Hooper
MGI ID: MGI:6729717
Synonyms: Sprr2a-
Gene: Del(3Sprr2a1-Sprr2a3)1Lvh  Location: unknown  Genetic Position: Chr3, Syntenic
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intergenic deletion
  Del(3Sprr2a1-Sprr2a3)1Lvh involves 3 genes/genome features (Sprr2a1, Sprr2a2, Sprr2a3) View all
 
Mutation detailsAn 81 kb genomic segment encoding Sprr2a1, Sprr2a2, and Sprr2a3 is deleted using CRISPR/Cas9 methodologies (gRNAs: GTGTAGAAAAAAGGATCGGTGGG (upstream), and ATTATCAGCGGTGTACTGCCAGG (downstream); GRCm38.p6: 92,210,732-92,291,813). (J:314159)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Del(3Sprr2a1-Sprr2a3)1Lvh Mutation:  1 strain or line available
References
Original:  J:314159 Hu Z, et al., Small proline-rich protein 2A is a gut bactericidal protein deployed during helminth infection. Science. 2021 Nov 5;374(6568):eabe6723
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory