About   Help   FAQ
Cimip4em1Yingz
Endonuclease-mediated Allele Detail
Summary
Symbol: Cimip4em1Yingz
Name: ciliary microtubule inner protein 4; endonuclease-mediated mutation 1, Ying Zheng
MGI ID: MGI:6728101
Synonyms: Tex33-
Gene: Cimip4  Location: Chr15:78262600-78280112 bp, - strand  Genetic Position: Chr15, 37.45 cM, cytoband E2
Alliance: Cimip4em1Yingz page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsExons 2-4 were targeted with two sgRNAs (targeting TACCAGAATCATCTAGTCCCTGG and GCTAGCCAAGGCCAACACCTGGG) using CRISPR/Cas9 technology, resulting in the deletion of the exons. (J:306891)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Cimip4 Mutation:  14 strains or lines available
References
Original:  J:306891 Xia M, et al., Testis-expressed protein 33 is not essential for spermiogenesis and fertility in mice. Mol Med Rep. 2021 May;23(5)
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory