About   Help   FAQ
Atxn7l1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Atxn7l1em1(IMPC)J
Name: ataxin 7-like 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6727371
Gene: Atxn7l1  Location: Chr12:33197692-33423184 bp, + strand  Genetic Position: Chr12, 14.03 cM, cytoband B2
Alliance: Atxn7l1em1(IMPC)J page
IMPC: Atxn7l1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTGTGATAACGATAAGCGG and TCTGGAGTGTAGCTGCAAGT, which resulted in a 478 bp deletion beginning at Chromosome 12 position 33,391,845 bp and ending after 33,392,322 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000655323 (exon 3) and 203 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acid 68. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Atxn7l1 Mutation:  36 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory